A spontaneous deletion of the Pou3f4 gene causing inner ear abnormalities.
Leona H Gagnon and Kenneth R Johnson
Source of Support: This research is supported by the NIDCD/NIH (DC04301, Kenneth R Johnson PI) and the NCRR/NIH (RR01193, Muriel T Davisson PI).
Mutation (allele) symbol: del-J
Mutation (allele) name: Pou3f4 deletion Jackson
Gene symbol: Pou3f4
Strain of origin: C3HeB/FeJ
Current strain name: C3HeB/FeJ-Pou3f4del-J/J
Stock #: 004406 (view JAX® Mice Data Sheet for additional information including Price and Supply Information)
Phenotype categories: behavior/neurological/hearing/vestibular/ear phenotype (J:116914 and J:83049)
Origin and Description
The Pou3f4 deletion-Jackson (del-J) mutation arose spontaneously at the Jackson Laboratory in the C3HeB/FeJ inbred mouse strain. Mutant mice are identified by three weeks of age by head shaking and circling behavior. Pou3f4del-J is a recessive, sex-linked mutation. Both hemizygous mutant males and homozygous mutant females have profound hearing loss, while heterozygous females and wild type controls retain good hearing.
Genetic Analysis
A high-resolution genetic map of the X Chromosome was produced by backcross linkage analysis to refine the location of the new sex-linked mutation now designated Pou3f4del-J. C3HeB/FeJ homozygous mutant females were mated with wildtype CAST/EiJ males. Resulting F1 female hybrids (+/del) were then backcrossed to hemizygous C3HeB/FeJ mutant males (del/Y). DNA samples from 98 backcross progeny (N2) were typed by PCR with simple sequence length polymorphism (SSLP) primer pairs distributed across the mouse X Chromosome, and the del mutation was localized between DXMit177 (102.0 Mb position, NCBI Build 36) and DXMit66 (134.8Mb). This region includes the previously identified Pou3f4 transcription factor gene, which is the mouse ortholog of the human POU3F4 gene and underlies non-syndromic hearing disorder DFN3. The Pou3f4 gene consists of a single 2.7 kb exon. The del mutation is a large deletion of approximately 100 kb that extends from 69.4 kb before the 5' end of Pou3f4 to 30.2 kb beyond the 3' end of the gene. The extent of the deletion was estimated by testing for the presence or absence of PCR products in mutant DNA using multiple primer pairs corresponding to known positions in the genomic region surrounding the gene.
We performed Southern blot analysis to confirm deletion of the Pou3f4 gene in mutant mice. A DNA probe was generated by PCR amplification of genomic DNA from C3HeB/FeJ wildtype (+/+) mice with primers that produce a 596 bp product specific to the coding region of Pou3f4: S-probe-F (GACCAGCAAGACGTGAAGC) and S-probe-R (TGAGCAGCGATCTTGTCAAT). The PCR amplified fragment was extracted from an agarose gel, purified with the QIAquick Gel Extraction kit (Qiagen, Inc., Valencia, CA #28604), and labelled with 32P using the Amersham Rediprime II Random Prime Labelling System (GE Healthcare Bio-Sciences Corp., Piscataway, NJ). The Pou3f4-specific probe failed to hybridize to restriction fragments from del/del DNA while hybridizing successfully to +/del and +/+ DNA, thus confirming deletion of the Pou3f4 gene in mutant mice (Fig 1).
Pathology
Four mutant mice and two controls from the inbred colony were assessed for hearing by auditory brainstem response (ABR). All mutants (36-74 days old) were completely deaf with no response to the highest ABR stimulus presented (115 dB), while the controls (one +/del female and one +/Y male) retained good hearing. We found no evidence of late-onset hearing loss in heterozygous females as previously described. In fact, 12 obligate female carriers of the del mutation (+/del) were assessed by ABR at ages ranging from 3 to 44 months of age, and they retained good hearing (Fig 2), comparable to the inbred control strain C3HeB/FeJ. The C3HeB/FeJ strain is resistant to age-related hearing loss and thus our analysis was not confounded by strain background effects, which could possibly account for the results reported by Xia et al. (2002) who analyzed the mutation on a mixed 129/Sv-C57BL/6 strain background. Our analysis of linkage cross mice also showed that heterozygous females (+/del) retained normal hearing equivalent to wildtype males (+/Y) at the 6-8 week test age (Fig. 3). Although most mutant females (del/del) and mutant males (del/Y) from the linkage cross lacked observable vestibular dysfunction, the hearing impairment was fully penetrant. The mean ABR thresholds of del/del and del/Y mutant mice were 40-50 dB higher than the mean thresholds of +/del and +/Y mice (Fig. 3).
A routine pathological screen failed to show any abnormalities in organs from a del/Y mouse with the exception of the inner ear. A clinical eye exam had normal results. We examined cross sections from two and five-month old mutant animals to determine if any morphological changes in the inner ear could be observed. Vestibular structures within the inner ear appeared normal; however, within the cochlea numerous abnormalities were observed. To control for histological artifact and tearing of tissue, inner ears were taken from five del/Y and four +/Y control mice and embedded in Epon resin. Mice were anesthetized and perfused intracardially with 5 ml of PBS/0.1% sodium nitrite followed by 5 ml of 4% para-formaldehyde. Cochleae were dissected and then fixed and decalcified in 10% formalin /0.14 M EDTA for 4 -5 d with a daily change of solution. The tissues were then treated with osmium tetroxide, dehydrated in graded alcohols, equilibrated in propylene oxide, and embedded in Epon (Electron Microscopy Sciences, Fort Washington, PA). The embedded cochleae were sectioned at 2 um and stained with 1% toluidine blue. The resulting histological preparations (Fig. 4) confirmed previously observed pathology reported by others, including an overall hypoplasia of the cochlea, a reduced number of cochlear turns, a failure to fully form the bony structure of the modiolus (especially apparent at the apex), and a consistent detachment of the stria vascualris (particularly in the base and mid portions of the cochlea).
Acknowledgements
We thank Sandra Gray for colony maintenance, Heping Yu for ABR, Coleen Marden and Rod Bronson for the gross pathology screen and Norm Hawes for the clinical eye exam.
References
Minowa O, Ikeda K, Sugitani Y, Oshima T, Nakai S, Katori Y, Suzuki M, Furukawa M, Kawase T, Zheng Y, Ogura M, Asada Y, Watanabe K, Yamanaka H, Gotoh S, Nishi-Takeshima M, Sugimoto T, Kikuchi T, Takasaka T, Noda T (1999) Altered cochlear fibrocytes in a mouse model of DFN3 nonsyndromic deafness [see comments]. Science 285:1408-1411.
Phippard D, Lu L, Lee D, Saunders JC, Crenshaw EB, 3rd (1999) Targeted mutagenesis of the POU-domain gene Brn4/Pou3f4 causes developmental defects in the inner ear. J Neurosci 19:5980-5989.
Phippard D, Boyd Y, Reed V, Fisher G, Masson WK, Evans EP, Saunders JC, Crenshaw EB, 3rd (2000) The sex-linked fidget mutation abolishes Brn4/Pou3f4 gene expression in the embryonic inner ear. Hum Mol Genet 9:79-85.
Xia AP, Kikuchi T, Minowa O, Katori Y, Oshima T, Noda T, Ikeda K (2002) Late-onset hearing loss in a mouse model of DFN3 non-syndromic deafness: morphologic and immunohistochemical analyses. Hear Res 166:150-158.