Totterer; a new mutation in the myelin protein zero (Mpz) gene.

Totterer:a new mutation in the myelin protein zero (Mpz) gene.

Authors: Son Yong Karst, Patricia F. Ward-Bailey, Richard Samples, David E. Bergstrom, Kenneth R. Johnson, Leah Rae Donahue and Muriel T. Davisson,

Source of Support: This research was supported by NIH/NCRR grant RR01183 to the Mouse Mutant Resource (M.T. Davisson, PI) and Cancer Center Core Grant, CA34196

Mutation (allele) symbol: ttrr

Mutation (allele) name: totterer

Gene symbol: Mpz^ttrr

Strain of origin: B6.129P2-Nos3^tm1Unc/J

Current strain name: B6.Cg-Mpz^ttrr/GrsrJ

Stock #: 010494 (view JAX® Mice Data Sheet for additional information including Price and Supply Information)

Phenotype categories: Neuromuscular

Abstract

A new spontaneous recessive mutation has been discovered and characterized at The Jackson Laboratory. Mice affected by the new totterer mutation have a neuromuscular phenotype causing a shaky gait. PCR and sequence analysis determined that this is a mutation in the myelin protein zero (Mpz) gene.

Origin and Description

The new spontaneous recessive totterer mutation arose in a production colony of B6.129P2-Nos3^tm1Unc/J mice at The Jackson Laboratory and was discovered by Victoria Gerrish. These mutant mice maintain normal weight and exhibit mild tremors first seen at about 2 weeks of age. The phenotype of the mutant mice slowly becomes more severe at six to eight weeks of age. Affected mice rapidly develop worsening muscle weakness characterized by a shaking, limb grasping, hunched, sprawled, and tottering walk. Affected animals have a shortened lifespan dying at irregular intervals. Female and male mutant mice may breed once or twice in their lifespan, but these animals often fail to breed. Female mutant mice are poor mothers due to the phenotype. This colony is also maintained by ovarian transplantation.

Genetic Analysis

Following our standard mapping protocols, a mouse homozygous for the ttrr mutation was mated with a CAST/EiJ mouse. This mating produced normal appearing F1 progeny. The F1 hybrid mice were then intercrossed to produce affected F2 mice for linkage analysis.

This mutation maps to Chromosome 1 between D1Mit114 (NCBI 37 position170.8mb) and D1Mit150 (NCBI 37position 176.5mb). Based on phenotypic similarities to the Mpz^tm1Msch knockoutalle and map location, the Mpz gene was considered a candidate gene for this new mutation. Sequence analysis revealed a mutation in exon 8. (See Photo)

A PCR product from genomic DNA was used to sequence the ttrr mutation. Primers were generated that produce a 517 base pair product flanking exon 8 of the Mpz wildtype allele; primer exon 8 Left (AAGTCCGGGACAGCAGTG) and primer exon 8 Right (GAGTACAAGACTTGGAAAGGAAGG). Sequence analysis of mutant DNA identified a four bp deletion and adjacent 12 bp duplication which alter the reading frame in the extracellular N-terminal region of the mutant MPZ protein.

Pathology

A routine pathological examination of eleven homozygous mutant mice revealed the following pathology consistant with central and peripheral demyelination:

One homozygous mutant at age 18 weeks had hypomyelination of peripheral nerves.

Two homozygous mice at age 18 weeks showed degeneration and paucity of peripheral myelin and also showed degeneration of the dorsal columns of the spinal cord.

Two homozygous mice at age 20 weeks showed thin peripheral myelin and degeneration of the dorsal columns of the spinal cord.

Two homozygous mice at age 23 weeks had hypomyelination of peripheral nerves.

One homozygous mouse at 26 weeks of age showed deficient peripheral myelin and myelin degeneration.

One homozygous mouse age at 28 weeks showed many nerves having too many Schwann cell nuclei, hyperproliferation of Schwann cells, poorly developed myelin, and preneoplasia. These abnormalities could develop nerve sheath tumors.

One homozygous mouse at age 32 weeks showed deficient peripheral myelin and large axons.

One homozygous mouse at age 33 weeks showed peripheral neuropathy with large axons with thin myelin sheaths and degenerating myelin in central part of cranial nerve 5.

The eyes of one homozygous mouse at 12 weeks of age were tested by an electroretinograph (ERG) and found to be normal.

Hearing as assessed by auditory brainstem response testing (ABR) of one homozygous mouse at 12 weeks of age showed normal hearing.

Acknowledgements

We thank Victoria Gerrish for discovery of the mutant, Roderick Bronson and Coleen Kane for pathological screening, Chantal Longo-Guess for hearing assessment,and Norm Hawes and Ron Hurd for eye examination.

The Jackson Laboratory